m0541 (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
m0541
M0541, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3465 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fidelity+pcr+master+mix/NEBNext+High-Fidelity+PCR+Master+Mix/pmc13098593-49-9-7
Average 99 stars, based on 3465 article reviews
M0541, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3465 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fidelity+pcr+master+mix/NEBNext+High-Fidelity+PCR+Master+Mix/pmc13098593-49-9-7
Average 99 stars, based on 3465 article reviews
m0541 - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Purification:Article Title: Detection of Emerging Vaccine-Related Polioviruses by Deep Sequencing Article Snippet: NEBNext adaptor for Illumina was ligated to the dA-tailed fragments using 136 NEBNext Ultra Ligation module and the adaptor was linearized by Uracil-Specific Excision 137 Reagent Enzyme following the manufacturer’s instructions. .. Adaptor ligated fragments were 138 purified using AMPure XP magnetic beads and the library was enriched by PCR using NEBNext 139 Magnetic Beads:Article Title: Detection of Emerging Vaccine-Related Polioviruses by Deep Sequencing Article Snippet: NEBNext adaptor for Illumina was ligated to the dA-tailed fragments using 136 NEBNext Ultra Ligation module and the adaptor was linearized by Uracil-Specific Excision 137 Reagent Enzyme following the manufacturer’s instructions. .. Adaptor ligated fragments were 138 purified using AMPure XP magnetic beads and the library was enriched by PCR using NEBNext 139 Polymerase Chain Reaction:Article Title: Detection of Emerging Vaccine-Related Polioviruses by Deep Sequencing Article Snippet: NEBNext adaptor for Illumina was ligated to the dA-tailed fragments using 136 NEBNext Ultra Ligation module and the adaptor was linearized by Uracil-Specific Excision 137 Reagent Enzyme following the manufacturer’s instructions. .. Adaptor ligated fragments were 138 purified using AMPure XP magnetic beads and the library was enriched by PCR using NEBNext 139 Article Title: Article Snippet: All stool samples sub packed in 2 ml Eppendorf tubes120 5 immediately were placed in -80 °C until analysis.121 The total bacterial genomic DNA was used as a template for PCR amplification122 of V1-V9 region of the bacterial 16S rRNA gene in a multiplex approach with the123 primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R124 (GGTTACCTTGTTACGACTT). .. PCR amplification was carried out using Phusion®125 Article Title: A new Leuconostoc citreum strain discovered in the traditional sweet potato sour liquid fermentation as a novel bioflocculant for highly efficient starch production. Article Snippet: Sour liquid fermentation is commonly used in the sedimentation process of traditional starch production, where bacteria play a critical role in starch flocculation.. In this study, the dynamic changes of bacterial compositions during sweet potato sour liquid (SPSL) fermentation were profiled using the single-molecule real-time (SMRT) sequencing, unveiling that Leuconostoc citreum, Leuconostoc pseudomesenteroides, Lactococcus lactis, and Lactobacillus plantarum were the dominant microorganisms in the process, and Leuconostoc citreum exhibited a strong positive correlation with starch flocculation rate (FR).. In total, 75 lactic acid bacterial (LAB) strains were isolated from the SPSL, but only 7 of them caused starch flocculation. Article Title: Analysis of the influence of living environment and age on vaginal fungal microbiome in giant pandas (Ailuropoda melanoleuca) by high throughput sequencing. Article Snippet: Accepted Manuscript Analysis of the influence of living environment and age on vaginal fungal microbiome in giant pandas (Ailuropoda melanoleuca) by high throughput sequencing Danyu Chen, Caiwu Li, Lan Feng, Zhizhong Zhang, Heming Zhang, Guangyang Cheng, Desheng Li, Guiquan Zhang, Hongning Wang, Yanxi Chen, Mingfu Feng, Chengdong Wang, Honglin Wu, Linhua Deng, He Ming, Xin Yang PII: S0882-4010(17)31153-1 DOI: 10.1016/j.micpath.2017.12.067 Reference: YMPAT 2703 To appear in: Microbial Pathogenesis Received Date: 11 September 2017 Revised Date: 26 December 2017 Accepted Date: 27 December 2017 Please cite this article as: Chen D, Li C, Feng L, Zhang Z, Zhang H, Cheng G, Li D, Zhang G, Wang H, Chen Y, Feng M, Wang C, Wu H, Deng L, Ming H, Yang X, Analysis of the influence of living environment and age on vaginal fungal microbiome in giant pandas (Ailuropoda melanoleuca) by high throughput sequencing, Microbial Pathogenesis (2018), doi: 10.1016/j.micpath.2017.12.067.. This is a PDF file of an unedited manuscript that has been accepted for publication.. As a service to our customers we are providing this early version of the manuscript. Article Title: Multi-armored allogeneic MUC1 CAR T cells enhance efficacy and safety in triple-negative breast cancer. Article Snippet: .. 10, eadn9857 (2024) 30 August 2024 17 of 21 High- Multiplex Assay:Article Title: Detection of Emerging Vaccine-Related Polioviruses by Deep Sequencing Article Snippet: NEBNext adaptor for Illumina was ligated to the dA-tailed fragments using 136 NEBNext Ultra Ligation module and the adaptor was linearized by Uracil-Specific Excision 137 Reagent Enzyme following the manufacturer’s instructions. .. Adaptor ligated fragments were 138 purified using AMPure XP magnetic beads and the library was enriched by PCR using NEBNext 139 Amplification:Article Title: Article Snippet: All stool samples sub packed in 2 ml Eppendorf tubes120 5 immediately were placed in -80 °C until analysis.121 The total bacterial genomic DNA was used as a template for PCR amplification122 of V1-V9 region of the bacterial 16S rRNA gene in a multiplex approach with the123 primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R124 (GGTTACCTTGTTACGACTT). .. PCR amplification was carried out using Phusion®125 Article Title: A new Leuconostoc citreum strain discovered in the traditional sweet potato sour liquid fermentation as a novel bioflocculant for highly efficient starch production. Article Snippet: Sour liquid fermentation is commonly used in the sedimentation process of traditional starch production, where bacteria play a critical role in starch flocculation.. In this study, the dynamic changes of bacterial compositions during sweet potato sour liquid (SPSL) fermentation were profiled using the single-molecule real-time (SMRT) sequencing, unveiling that Leuconostoc citreum, Leuconostoc pseudomesenteroides, Lactococcus lactis, and Lactobacillus plantarum were the dominant microorganisms in the process, and Leuconostoc citreum exhibited a strong positive correlation with starch flocculation rate (FR).. In total, 75 lactic acid bacterial (LAB) strains were isolated from the SPSL, but only 7 of them caused starch flocculation. Agarose Gel Electrophoresis:Article Title: Article Snippet: All stool samples sub packed in 2 ml Eppendorf tubes120 5 immediately were placed in -80 °C until analysis.121 The total bacterial genomic DNA was used as a template for PCR amplification122 of V1-V9 region of the bacterial 16S rRNA gene in a multiplex approach with the123 primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R124 (GGTTACCTTGTTACGACTT). .. PCR amplification was carried out using Phusion®125 |